Query (optional)   in Class  

GrainGenes Sequence Report: FB292782

[ Printable Version ]  [ Submit comment/correction ]

Sequence
FB292782
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum sp.
Species
Triticum sp.
Data Source
genbankDownloaded 2008-2009
Title
Sequence 100 from Patent EP1845161.
Remark
DB_xref: taxon:4569
Feature: source: mol_type = 'unassigned DNA';
DNA
cgtccgcggacgcgtgggtgcttattcagtcaatctgccgcactttctat
ggaagagatctgctgttgttgcagcactctgcatattagcagtgcgtgcg
gtgatagttcaactggcattttttctccacattcagacatttgttttcag
aaggccggcagacttttcaaagccattgatatttgcaactgccttcatga
cattcttctcagttgtaatagcattattcaaggatatacccgatattgaa
ggggaccgcatctttggaatccaatcttttagtggtagactaggtcaaag
caggggtttctggacttgcgttggcctacttgaggttgcctacggtgttg
cgatactgaggggggtaacttcttccagtttgtggagcaaatctataact
gttgtgggccatgcaatcctc
BLAST
BLAST Search