Query (optional)   in Class  

GrainGenes Sequence Report: G05112

[ Printable Version ]  [ Submit comment/correction ]

External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Pseudoroegneria spicata
Pseudoroegneria spicata
Clone Library
Pseudoroegneria spicata Wang&Wei
Data Source
genbankRelease 135, Apr 15 2003
2P-PCR-S Pseudoroegneria spicata Wang&Wei Pseudoroegneria spicata STS genomic, sequence tagged site.
DB_xref: taxon:4604
Feature: primer_bind: On complementary strand.
Feature: source: mol_type = 'genomic DNA';
Locus Comment: Contact: Richard Wang; Forage and Range Research Laboratory; USDA-ARS, Utah State University; 695 N 1100 E, Logan, UT 84322-6300, USA; Email: rrcwang@cc.usu.edu; Primer A: ACAATCTGAAAATCTGGACA; Primer B: TCATATTGAGACTCCTATAA; STS size: 251; PCR Profile:; Presoak: 0 degrees C for 0.00 minute(s); Denaturation: 93 degrees C for 1.00 minute(s); Annealing: 52 degrees C for 1.00 minute(s); Polymerization: 71 degrees C for 2.00 minute(s); PCR Cycles: 28; Thermal Cycler: Perkin Elmer 9600; Protocol:; Template: 40 ng; Primer: each 3 uM; dNTPs: each 200 uM; Taq Polymerase: 0.04 units/ul; Total Vol: 25 ul; Buffer:; MgCl2: 2.5 mM; KCl: 50 mM; Tris-HCl: 10 mM; pH: 8.3.
Note: V-type: Unknown
EMBL Feature
primer_bind120Location: 1..20
primer_bind232251Location: complement(232..251)
STS1251Location: 1..251
BLAST Search