Query (optional)   in Class  

GrainGenes Sequence Report: J01897

Sequence
J01897
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
18S ribosomal RNA
ribosomal RNA
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat cytosol 18S rRNA 3' terminus.
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'rRNA';
Locus Comment: Original source text: Wheat cytosol rRNA.
EMBL Feature
rRNA
DNA
ccccgacgtcgcgagaagtccattgaaccttatcatttagaggaagcaga
agtcgtaacaaggtttccgtaggtgaacctgcggaaggatcattg
BLAST
BLAST Search