Query (optional)   in Class  

GrainGenes Sequence Report: J03897

Sequence
J03897
Subsequence
J03897_1.cds11239
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC153961
NCBI UniGene
Hv.12403
Data at Gramene
Gramene-Protein P07519
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Carboxypeptidase I precursor'
Keyword
carboxypeptidase
Species
Hordeum vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
H.vulgare (barley) carboxypeptidase I mRNA, 3' end.
Gene Product
CBXI mRNA
carboxypeptidase I A chain
carboxypeptidase I B chain
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Barley (H.vulgare L.) scutellum, cDNA to; mRNA, clone lambda c-1.; Draft entry and computer-readable sequence for [1] kindly provided; by G.B.Fincher, 10-MAY-1988.
EMBL Feature
mat_peptide1627Location: <1..627
mat_peptide7931236Location: 793..1236
DNA
ggcggccccggctgctccagcttcgacggcttcgtctacgagcacgggcc
attcaatttcgagtcgggcgggtcagttaaaagcctgccaaagctccatc
tcaacccttatgcctggtccaaggtgtctaccatgatatacctggactcc
cctgctggcgtggggctgtcatactcgaagaatgtttcagattatgaaac
gggagacctcaagaccgcgacggattcgcatactttccttctcaagtggt
tccaattgtaccctgagttcctgagcaacccgttctacatagctggggag
tcgtatgctggggtttatgtccctactctttcgcacgaagtcgtcaaagg
gatacaaggaggagctaagccaactataaacttcaagggctacatggtcg
ggaatggcgtctgcgacactatctttgatggcaatgctcttgtgccattt
gcacatggaatgggtctaatatcagatgaaatataccagcaagctagtac
gtcgtgccacggaaattactggaatgccactgacggtaaatgtgataccg
ctatatcgaaaatcgaatcgttgatcagcggacttaacatttatgacatt
cttgagccatgctaccacagcagaagcatcaaagaagtgaacctgcagaa
tagcaaattgcctcaaagtttcaaagatcttggtacaactaacaagccat
ttcccgtaagaacgagaatgctggggcgtgcttggcctttgagagctcct
gtaaaagccggacgtgttccgtcatggcaggaagttgccagtggtgttcc
atgcatgagcgacgaagttgcaacagcatggcttgacaacgctgccgtca
gatctgcaatccatgcccaatcagtaagtgcaattgggccatggctctta
tgcacagataaattgtatttcgttcatgatgctggtagtatgatcgctta
tcacaagaacctcacaagccagggttatcgtgccatcatattcagtggcg
accacgacatgtgtgtgccattcaccgggagtgaagcatggacaaaatct
ttggggtatggagttgttgactcgtggcggccatggatcacaaacggaca
agtttctgggtacaccgaaggatatgaacatggtctcacttttgctacta
ttaagggtgctggacacaccgttcctgagtacaaaccacaggaagcattt
gctttctacagccgttggctcgctggttcaaagttgtgaagcttgtgccc
agctacaaataatggggaatatacttctgcatacagtcaagaatgaacaa
atagagacttgaagaagaaagagatggcctacacgccatatagatagtca
catacccaaatatcaaaaatagcaattggaacactgtgcgttgtattctt
tcatcaaatatatttggtcgatgc
BLAST
BLAST Search