Query (optional)   in Class  

GrainGenes Sequence Report: J01236

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J01236
Subsequence
J01236_1.cds971413
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC153933
NCBI UniGene
Hv.68
Data at Gramene
Gramene-Protein P00693
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Alpha-amylase type A, EC 3.2.1.1'
Keyword
alpha-amylase
amylase
Species
Hordeum vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley alpha-amylase type A isozyme mRNA, complete cds.
Gene Product
a-amyl mRNA
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Barley (Hordeum vulgare L. cv. Himalaya 1979; crop) aleurone cell stimulated with gibberellic acid, cDNA to mRNA,; clone E.; [1] suggests that there are two alpha-amylase genes in barley; aleurone cells (types A and B), and that expression of these genes; is affected differently by gibberellic acid. It is likely that; alpha-amylase contains a signal peptide and a mature peptide. The; latter would start at about position 172 (by comparison with; alpha-amylase type B). A poly-A signal is located at positions; 1557-1562.
DNA
atcagtcgatcagccagtcagccaatccttcattcatccggagaagaaaa
ggagtgttctgtactgtaagtgagacaatcgacagtagcgcgcgccatgg
ggaagaacggcagcctgtgctgcttctctctgctgctgctgctgcttctc
gccgggttggcgtccggccaccaagtcctctttcaggggttcaactggga
gtcgtggaagcagagcggcgggtggtacaacatgatgatgggcaaggtcg
acgacatcgccgctgccggagtcacccacgtctggctgccaccgccgtcg
cactccgtctccaacgaaggttacatgcctggtcggctgtacgacatcga
cgcgtccaagtacggcaacgcggcggagctcaagtcgctcatcggcgcgc
tccacggcaagggcgtgcaggccatcgccgacatcgtcatcaaccaccgc
tgcgccgactacaaggatagccgcggcatctactgcatcttcgagggcgg
cacctccgacggccgcctcgactggggcccccacatgatctgtcgcgacg
acaccaaatactccgatggcaccgcaaacctcgacaccggagccgacttc
gccgccgcgcccgacatcgaccacctcaacgaccgggtccagcgcgagct
caaggagtggctcctctggctcaagagcgacctcggcttcgacgcgtggc
gccttgacttcgctaggggctactcgccggagatggccaaggtgtacatc
gacggcacatccccgagcctcgccgtggccgaggtgtgggacaatatggc
caccggcggcgacggcaagcccaactacgaccaggacgcgcaccggcaga
atctggtgaactgggtggacaaggtgggcggcgcggcctcggcaggcatg
gtgttcgacttcacgaccaaagggatactgaacgctgccgtggagggcga
gctgtggaggctgatcgacccgcaggggaaggcccccggcgtgatgggat
ggtggccggccaaggccgccaccttcgtcgacaaccacgatacaggctcc
acgcaggccatgtggccattcccctccgacaaggtcatgcagggctacgc
gtacatcctcacccaccccggcatcccatgcatcttctacgaccatttct
tcaactgggggtttaaggaccagatcgcggcgctggtggcgatcaggaag
cgcaacggcatcacggcgacgagcgctctgaagatcctcatgcacgaagg
agatgcctacgtcgccgagatagacggcaaggtggtggtgaagatcgggt
ccaggtacgacgtcggggcggtgatcccggccgggttcgtgacctcggca
cacggcaacgactacgccgtctgggagaagaacggtgccgcggcaacact
acaacggagctgaagtctgcactgatccgtcattcgatcgagcatgaatt
tcctgaagtacatgattcacttctggtattcacgcggatatgattaacta
tgtatacctgtacccaaaattgatgagctatacgaattgctcacacgact
gtagtaaataaagtactgaggatacgaagaggtttaat
BLAST
BLAST Search