Query (optional)   in Class  

GrainGenes Sequence Report: J01237

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J01237
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
NCBI UniGene
Hv.23108
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'B3-hordein fragment'
Keyword
hordein
Species
Hordeum vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
barley b1 hordein mrna (partial).
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: barley(hordeum vulgare l. cv. sundance)cdna; to endosperm mrna.
DNA
ctcaacttgaggcgacaacttccattgcgttgcgtaccctaccaacgatg
tgcagtgttaatgtgccgttgtaccgcatagtgccattagccattgacac
cagagttggtgtctaatgataagaaaagggtcttctagaaatatatagtt
ga
BLAST
BLAST Search