Query (optional)   in Class  

GrainGenes Sequence Report: J01264

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J01264
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Secale cereale (rye)
Keyword
repeat region
Species
Secale cereale
Data Source
genbankRelease 135, Apr 15 2003
Title
rye (s.cereale) heterochromatin repetitive sequences.
Remark
DB_xref: taxon:4550
Feature: source: mol_type = 'genomic DNA';
Locus Comment: Original source text: rye (secale cereale).
DNA
gaattcaaacatttcgaaacacacaagcaatttctacaaatggaaaaaat
aaactccccaaataaaactgagaatacgaacattttttgaatggcaaaac
agatttcggatacgcggacagttttgaaaaatgggaacttttttttaatc
taccgaataaaatttgaaaacaccaacattttttgaaactccagaacaaa
atttgaagcacgaacaattttttaaatcccagatcagaatttgaaaacat
gaacactatatgaaaattttccacgcacgtaatcctgtgtgtgcatgtat
gtaaaatcctccagatcgtaaaaactagaagtcctatcacctcaattccc
caatagctttccaacgcctatgaaaacgacgaaatcggtgcttgttctca
cttgctttgagagtctcgatcaattcgaactctaggttgatttttgtatt
ttctttgatcaccgtttcttcgcgagagttggcctaacaccctattgtat
ccatacatgggtggggcgcccaggacctgaacaccaaagtgatatgccgg
ctcatcaaaatttgagctgtaattgcgataactttcattttttccaatcc
tgcaggccatttttgagggccaagacgaccctttttgggctcagaattc
BLAST
BLAST Search