Query (optional)   in Class  

GrainGenes Sequence Report: J01309

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J01309
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
NCBI UniGene
Ta.48416
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Low molecular weight glutenin subunit'
Keyword
gliadin
seed storage protein
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
wheat storage protein (gamma-gliadin) mrna, partial.
Probe
J01309
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: field grown wheat(chinese spring) cdna to; immature endosperm mrna.; submitted as clean copy.
DNA
caacaaccaccgttttcgcaacaacaacaaccagtactaccgcaacaacc
accattttcgcaacaacaacaaccaattctaccacaacaaccaccatttt
cgcaacaacaacaacaaccagttctaccacaacaacaaatactatttgtt
catccatctatcttgcagcagctaaacccatgcaaggtattcctccagca
gcaatgcagccctgtggcaatgccacaaagtcttgctaggtcgcaaatgt
tgcagcagagcagttgccatgtgatgcaacaacaatgttgccagcagttg
ctgcaaatcccccagcaatcccgctatgaggcaatccgtgctatcatcta
ctccatcatcctgcaagaacaacaacaggttcagggttccatccaaactc
agcagcagcaaccccaagagttgggccaatgtgtttcccaaccccaacag
cagcagtcgcagcagcaactcgggcaacaacctcaacaacaacaattggc
acagggtacctttttgcagccacagcaggtagctcagcttgaggtgatga
cttccattgcgctccgtaccctaccaacgatgtgccgtgtcaatgtgccg
ttgtctagaaccaccactagtgtgccattcggcgttggcgccggagttgg
tgcctactgataaggtttggtctctagtaatatatagttggatcaccgtt
gtttagtcgatggatatgtcgatgcagcggtgacaaataaagtgtcacac
aacgtcgtgtgtgacccgcccaaactagttgtttaaattctgaaataaaa
tacaaataaagttgtatc
BLAST
BLAST Search