Query (optional)   in Class  

GrainGenes Sequence Report: J01458

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J01458
Subsequence
J01458_1.cds168413
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC337804
DB Remark
Locus Source: chloroplast Triticum aestivum (bread wheat)
Keyword
ATPase
DCCD-binding protein
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat chloroplast ATP synthase proton-translocating subunit gene.
Remark
DB_xref: taxon:4565
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'genomic DNA';
Locus Comment: Original source text: Wheat chloroplast DNA, clone pTAC60.; The sequence coding for the ATP synthase subunit was confirmed by; determination of the first 40 N-terminal amino acids. This sequence; shows 100% homology to the spinach protein amino acid sequence. It; is 35% or less homologous to the corresponding sequences of the; bacterial and mitochondrial proteins. The proton-translocating; subunit is also known as the DCCD-binding proteolipid.
DNA
gaattcccttctatgtagttcggacaattcacattatcatttcaatttga
tttcaatttgtactttttagttactttacttctccccaatagagcttaga
agtaagaatttattggttgattgtatccttaaccatttcttttttttgac
acgaggaactactcaccatgaatccactaattgctgctgcttctgttatt
gctgctggattggccgtagggcttgcttctattggacctggagttggtca
aggtactgctgcaggacaagctgtagaaggtattgcgagacagccagaag
cagaaggtaaaatacgaggtactttattgcttagtctagcttttatggaa
gctttaacaatttatggactagttgtggcactagcgcttttatttgcgaa
cccttttgtttaatcttaaaaaaaaattctttcgatttcgattagatact
tttttctttttttagtaaattggtatttgcttccgcaattccaattatat
c
BLAST
BLAST Search