Query (optional)   in Class  

GrainGenes Sequence Report: J01895

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J01895
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
transfer RNA
transfer RNA-Gly
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat germ Gly-tRNA-1.
Gene Product
tRNA-Gly
Remark
DB_xref: taxon:4565
[ Show all 9 ]
EMBL Feature
modified_base44Location: 4
[ Show all 11 ]
DNA
gcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgg
gttcgattcccggctggtgcacca
BLAST
BLAST Search