Query (optional)   in Class  

GrainGenes Sequence Report: J01896

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J01896
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: mitochondrion Triticum aestivum (bread wheat)
Keyword
18S ribosomal RNA
ribosomal RNA
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat mitochondrial 18S rRNA, 3' terminus.
Gene Product
18S ribosomal RNA
Remark
DB_xref: taxon:4565
Feature: source: organelle = 'mitochondrion'; mol_type = 'rRNA';
Locus Comment: Original source text: Wheat mitochondria rRNA.
EMBL Feature
rRNA197
DNA
tttggtggtcttattggcgcataccacggtggggtcttcgactggggtca
agtcgtaacaagctagccgtaggggaacctgtggctgcattgaatcc
BLAST
BLAST Search