Query (optional)   in Class  

GrainGenes Sequence Report: J02817

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J02817
Subsequence
J02817_1.cds10524888
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC340244
Data at Gramene
Gramene-Protein P11515
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
gibberellin responsive protein
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat gibberellin responsive protein gene, complete cds.
Probe
GIRP
Remark
DB_xref: taxon:4565
[ Show all 13 ]
EMBL Feature
prim_transcript10095002GIR mRNA and intronsLocation: 1009..5002
[ Show all 18 ]
DNA
ggaataataaaactcgtcggttctacctagagtcgctactcgtagtacta
attactcaacttggttgggcacgccaccccatgcatgggtgggttaaatt
caattcggatggctccttctcagaggagggacgagctggttcgagtatgg
tgttacgtgacaatcaaggttcaattattttctcatagtgcagagagttg
ttctcttgtcgaggtgctttggaagccgagctgggagcatgcatggaagg
tctctcgctagcaatgatgcatactgacctgccgatggcgattgagatga
actcttcagtagctataaagatgattcagtcaagcgatacagatagatca
ctttactcgtcgctggtgaatgagattaagtacttgattagtctccataa
aactagtattactcatgtcagttgctcccaaaataaagttagtaactctt
tgacaaattttgctcgtgtggatggtacaacaatgacctggtttgggtct
ggacctccagaggccattgagctcaacgacattgattatttcgagagtac
aacgacattgattgtaatcttgtgtgatgtgagtaatacaaagttttacc
cgccattatttttttttactttgctgaaagaacggataaagccctctttt
ttgcgggtgtaataaagcccttctttatgccctgcttccctggatgtggg
aagtttctttttcacggcaggtacgggcaccgtctgatccgcaccatgat
tcggatcagattaggatttttttatcagacttattataacaataacaatt
aaataacacgctgataatacaaaacagtcgtgtccaaatacaaaaggcaa
aaaaaaagaatttaaaaagcagaggaatctcatctcaggaagcgcttcca
agcaaagtcaagaacagagcacagcaccagcagcagtccgttgcaagctc
caccccgaaatccagcgctccccacgctataaagcccggggatatggacg
gaacctccgccaaatccccacgaaaccgccacctccccaccatcgttacc
aatggcgacgaccccgcgcctcgcctccctgctcctcctgctcgcgctct
gcgccgcggcggccggcgcgctccggctgcccccggacgccagcttcccg
ggcgcgcaggccgagcgcctcatccgcgcgctcaacctgctcccggggcg
tcctcgccgcggcctcggtgcgggggcggaggacgtcgcgcccgggcagc
tgctggagcgccgggtcacgctccccgggctgcccgagggcgtcggcgac
ctcggccaccacgccggctactaccgcctccccaacacccacgacgccag
gtcagtcagagacatgccgacactccggccaccgcgccttagctccggcg
gatccgtggccctctgatgctaattcgcggctgtttctgcgccaaattcc
aaggctttctagcccgtaacggccggcggcgattggggaacggtttttgg
aagtgaaattaatgaatggattccttgcgcaggatgttctacttcttctt
cgagtcgcggggcaagaaggaggaccccgtggtgatctggctcaccggcg
gcccgggctgcagcagcgagctcgccgtcttctacgagaacgggcccttc
accatcgccaacaacatgtccctcgtctggaacaagttcggctgggacaa
ggtaggcaatctcatcccctttaattaccatgcactttattaatcttcca
aataatgctttatacgtttcgtcaaggaagaaagaaaccggatgctttgc
tcacctagcacgtaaccgctaaaaaattactcacctgaatttttgaaact
gaagtctgaaactgtcgcctaattctgggtgaaagtaactgctctgaagt
ctgaactgaagtgttttttctgtgctgatgctacttgctgcctgcagatt
tcaaacatcatatttgttgacccagccaccgggacagggttcagctacag
ctccgacgaccgcgacacccgtcacgacgaggcaggggtcagcaatgacc
tctatgattttctccaggtactgtttttggtccaagatgcagttcacttc
ttctgtactttataaattgatggtgacgagatgatacactactactggag
agaacttggttaattcattcagtaaggaccattttagcaagatatgctaa
aatatcctctagtgtaagattaatcatcgtataacgacatagcaacaaga
ataaacacatcagggcactcttctatttatagtaggttggtagtatcagt
taataatattgctcatatatagtgcagttctgctttcttaaggcacaaca
attccattacgattggatactcccaccggagcatgacccttttgtttctg
attaagtgcattacaagatgttttcggtactttctgcattcagagctagc
tatttttgcaccccttgatccaccagaacaatccaagagttaggcaggta
ccccccctccccccagactgattgtgtgtcctcttcaatctgtccatagt
gtgcattgatgctcatgcctgatagtgtgcgtctgtaccgcatagattgt
tcaggctggaatcggggacttgcttacgcaaaaaaatgaatataccaaat
tgaatgcatatcttcattagaggtggtaaacgataatttacctaaaattt
agccttcagaacagaccagatgaagtagaagaaccatatcttcattatag
ctgcatattgtactattgttctaaggtctgattatttagattttgttgaa
tatagcaaaaacagagaagtactgtgtagtaattatctgttcttaactcc
catttcaggtcttcttcaagaagcacccggaatttgtaaagaacgacttc
tttataaccggagaatcctatgctgggcactacattccagcatttgcgag
ccgagttcaccagggaaacaagaagaatgagggcactcacataaacttga
aggtaagatccttaccgaagttcgtgttgcctttattaattctctattga
tgatttggttctttcttaatatgcgtctctcttatttgtattatagggat
ttgcgatcggtaatggcctcacagatccagcaatccaatacaaggcctac
acagactacgcgttggacatgaaccttattcagaaagctgactatgacag
gatcaacaaattcatcccaccatgtgaatttgcaatcaaactttgtggtc
agtactacataaatgcttttgaactaaatgctctgtttccttgttattat
ttggaaaagataagagcattgtgatgccattgcctgagaataacatgcac
atatttccaactgtcaaacttcttgaaagttgaatgaatccatttatagg
gtataaatgaggttaactaatgttgcatacatttttttggtaaaaaaata
aagtattctacacagtatctaggtttattttctaccaaacaacacatttt
gtttaactacaaaacaacacattcaaatcacatcctgatacctgaggatt
tcttaaaagaaaatgtccctaacgacatgcttatgtttcaggtacagatg
ggaaagcatcttgcatggcagcatatatggtctgcaatagcatcttcaac
tctatcatgaagcttgttggtacaaagaatgtaagtgagaaactgatgtt
aattttactaatagcatcagtagactaagactaagaaacatattattagc
ggttataaactgaaacttgctaatggcctctttacagtattacgacgtta
ggaaggagtgcgaagggaaactctgctacgacttctcaaacttggagaag
ttctttggcgataaagcagtcagacaggcgattggagtaggtgacattga
attcgtctcatgcagcacttcagtttatcaagcgatgctcacagactgga
tgaggaacttggaagtcggcatcccagctctactcgaggatgggatcaat
gtgctcatatatgctggggaatatgaccttatatgcaattggctcggtaa
ggatatgttgaagccgatatgtttttgagtcgttctgcaaatttgcttcg
tcataactaattaagtaatgagatgtcccccatttataagtagctcgata
tagctcgcttttcatgacaggagctttacaggtccttttctaggtgaata
agaacaccagcatcccagtttctgaatcctacttaacctaataacatgtt
aaaataaagtttatgcttagcctgatgttctgcattgtcttacacattat
cagattatttgatgtatttcatttaatatgtcaagtgtaacattgtttat
gttttgagcaggaaactcaaggtgggtccactccatggaatggtctggtc
agaaagactttgccaaaaccgctgaatcatcgttcttggtagacgatgcc
caagctggagttctgaagagccacggtgcactcagtttcctcaaggtttg
tgaactgtgattaagcactttttttcactttatctcgatatacccactgc
tcccaaaaataatccgaaagaagttggcccatgatttttttgaacaaact
ttttgcatcagtaaatgtgcctagatggccttgtaaagcatggtcctaac
tttacgctgaaacaactcagctatactacctaaatactaacaagtacatg
gcccatctagattactgactagtactctgtttctgttcgcgcgaatgcag
gttcacaatgctggccacatggtccccatggaccagccgaaggccgccct
cgaaatgctgaggagattcacgcaagggaagctcaaggagtctgttccgg
aagaggagccagcgacgacgttttatgccgcgatatgatcgataccgacc
aaagaaggggggaaaactcgctaggtggcccgttgcggtctcaaggagtg
tctatctgtagctgtctgtttcctttccatgcaccccctcttttccttcc
ccccttgtttcagctggatatgtataaccactaataacaagaaggttggc
cccgaaatgtaactgcacgatgtgtgctcgatgttgatgaaggatggaat
acaacacaccatgggggccgatgtttgagaggcttgctcatgttttaatc
atgtcgatgtgtgcgtgctctgtctttctcgctttgatctgtcaagaagg
aaaatactttctggtttgtttcatcttgggaagggccattccctgtgagt
cacacaaacaaggcgactcgtccccttcttcaaacataatgcagttcaat
gcttttagattggcc
BLAST
BLAST Search