Query (optional)   in Class  

GrainGenes Sequence Report: J02961

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J02961
Subsequence
J02961_1.cds1561
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein P10969
DB Remark
Locus Source: Triticum turgidum subsp. durum (durum wheat)
Keyword
agglutinin
Species
Triticum turgidum subsp. durum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat (T.durum) germ agglutinin mRNA, 3' end.
Strain
subsp. durum
Gene Product
AGG mRNA
Remark
DB_xref: taxon:4567
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Wheat (T.durum cv. Mexicali) developing; grain, cDNA to mRNA, clone pNVR1.; Draft entry and printed copy of sequence for [1] kindly provided by; N.V.Raikhel, 23-JUL-1987.
DNA
caaaggtgcggcgagcagggcagcggcatggagtgccccaacaacctgtg
ctgcagccagtacggctactgcgggatgggcggcgattactgcggcaagg
gctgccagaacggcgcgtgctggaccagcaagcggtgtggcagccaggcc
ggcggcaagacgtgccccaacaaccactgctgcagccagtacgggcactg
cggcttcggcgcggagtactgcggcgccggctgccagggcggcccctgcc
gcgccgacatcaagtgcggcagccaggccggcggcaagctgtgccccaac
aacctctgctgcagccagtgggggtactgcggcctcggttccgagttctg
cggcgagggctgccagaacggcgcttgcagcaccgacaagccgtgtggca
aggacgccggcggcagggtttgcactaacaactactgctgtagcaagtgg
ggatcctgtggcatcggtcccggctactgcggtgcaggctgccagagcgg
cggctgcgatggtgtcttcgccgaggccatcgccaccaactccactcttc
tcgcagaatgatgatcttgctaatggtagtattgcaacgacgcataatcc
gtggcagttccattgccacgtacggttttcccttcacttacttttagtac
tagtacttaataattctctagcttgcaatatgacatgcaggttactgcag
cagaaacaaaatattgctgtagtacatgcatggaaatattaccgagagaa
gtgttgtgtggcaatatagagtgtactataggcgccacaaattagtgttc
ttgttatgacctgctgtcaggatcgatgcatgcatcgctgttgtaatgtt
ggagtacttcgtgatatcgttgcaatatattaccatgagtctcacatc
BLAST
BLAST Search