Query (optional)   in Class  

GrainGenes Sequence Report: J04106

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J04106
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: chloroplast Aegilops crassa
Keyword
mutational hot spot region
Species
Aegilops crassa
Data Source
genbankRelease 135, Apr 15 2003
Title
Ae.crassa chloroplast hot spot region for mutations.
Remark
DB_xref: taxon:4481
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'genomic DNA';
Locus Comment: Original source text: Ae.crassa seedling chloroplast DNA, clone; pAecB2l.; Draft entry and computer readable sequence for [2] kindly provided; by Y.Ogihara, 28-SEP-1988.
EMBL Feature
misc_feature101105mutational hot spotLocation: 101..105
misc_feature545553mutational hot spotLocation: 545..553
DNA
acaaatcgagattcgtctattctatatatctagaatatatatattaaggt
ataatacaataaagaaatacaaataaaataataaaataataaaatatagt
attatcatatgatcatgataatggaatcaaatacgcagtatttacagaaa
aaagtcttcgtttattgggaaagaatcaatatacttttaatgtcgaatcg
ggattcactaagacagaaataaagcattgggtcgaactcttctttggtgt
taaggtggtagctgtgaatagccatcgactacctggaaaaggtagaagaa
taggacctattctgggccatacaatgcattacagacgtatgatcattacc
cttcaaccgggttattctattccacttctagatagagaaaaaaactaaag
gagaatgaatgaaaaaagacatagtttggaagttagacctttttatagga
ctctctttcaatttcaaaaaagaggacgtttgaaacttttaacaggcgta
atcgtgagtcaacaagtgactcgaactgtgtgtaaaaaaagaaccatttt
tttttttcaaaatgctagaactagataaggaagttttctataaccttgag
aaaaaggataaaaaggtagttttttttttagtttatgactccgatcaaga
gcgagaaatccttgatttgggattggacatatgaacctggacccatcgta
gagacgtttagttcaaaagaaaggatcgtatcctgatggtaagaattata
ctttcgtggaaatacagcgctatagacttcaatgcggtagagtagacgtt
ttgttcctaatttttctggaccaaacctccgctccgacccaacgatacaa
tgaattttttctgttcctattcataaataaaaaagattcggaatcgcaat
gctactatatgcgtccagaggagtatttggaataatattcttctataatc
cattattgcggggggaatcttactaacagggcttcgctgcacgggacggg
tcttcgtcgaaaagctaactccacccggcattttcataccctttcttttg
ggtggtatatcgccttttaaagtctaagagggtagtaggggatctatagt
aggtaagataatttgccctttgattttgattgaatatactattttttccg
cctttaccacgcattattgtatgcgcttctagagaagtatgtatgcagga
agtaaattctaaccgctttcttttgaatccaatttcaaattagattagaa
agagagaaaggccatgaggatgggaaaatcaaaataaaatttttttaatt
agttctccttttttggaattttcttattatcctttcatttttttacagaa
tattttcaaactaaaaataaaaaatacaatacaatagtaatattccttat
aatagatatacttaattatatcataagaatcttaag
BLAST
BLAST Search