Query (optional)   in Class  

GrainGenes Sequence Report: J04107

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J04107
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: chloroplast Triticum aestivum (bread wheat)
Keyword
mutational hot spot region
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
T.aestivum chloroplast hot spot region for mutations.
Remark
DB_xref: taxon:4565
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'genomic DNA';
Locus Comment: Original source text: T.aestivum (strain Asakaze-homugi) seedling; chloroplast DNA, clone pTacB2.; Draft entry and computer readable sequence for [1] kindly provided; by Y.Ogihara, 28-SEP-1988.
EMBL Feature
misc_feature101109mutational hotspotLocation: 101..109
DNA
aggactctctttcaatttcaaaaaagaggacgtttgaaacttttaacagg
cgtaatcgtgagtcaacaagtgactcgaactgtgtgtaaaaaaaaagaag
cattttttttttacagaatatttttcaaactaaaaataaaaaatacaata
caatagtcaatattccttataatagatatacttaattatatcataagaat
ct
BLAST
BLAST Search