Query (optional)   in Class  

GrainGenes Sequence Report: J04108

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J04108
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: chloroplast Aegilops tauschii
Keyword
mutational hot spot region
Species
Aegilops tauschii
Data Source
genbankRelease 135, Apr 15 2003
Title
Ae.squarrosa chloroplast hot spot region for mutations.
Remark
DB_xref: taxon:37682
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'genomic DNA';
Locus Comment: Original source text: Ae.squarrosa seedling chloroplast DNA, clone; pAesB25.; Draft entry and computer readable sequence for [1] kindly provided; by Y.Ogihara, 28-SEP-1988.
EMBL Feature
misc_feature101105mutational hotspotLocation: 101..105
DNA
acaaatcgagattcgtctattctatatatctagaatatatatattaaggt
ataatacaataaagaaatacaaataaaataataaaataataaaatatagt
attatcaattgtatgcgcttctagagaagtatgtatgcaggaagtaaatt
ctaaccgctttcttttgaatccaatttcaaattagattagaaagatagaa
agg
BLAST
BLAST Search