Query (optional)   in Class  

GrainGenes Sequence Report: J04202

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J04202
Subsequence
J04202_1.cds4661958
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC168840
Data at Gramene
Gramene-Protein Q03651
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Keyword
alpha-amylase
amylase
Species
Hordeum vulgare subsp. vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley alpha-amylase type B (Amy46) gene, complete cds.
Strain
Himalaya
Gene Product
alpha-amylase
Remark
DB_xref: taxon:112509
[ Show all 7 ]
EMBL Feature
mat_peptide541552Location: join(541..552,656..1600,1707..1955)
[ Show all 8 ]
DNA
ctcgagaaacgcacctcatccacgttattcaggaaaatttgccaggaatt
ttctgacccggatttctgctttgttaacctgaaatgcgcaagtaaccgtc
agttgcctgcagatcttacggtgcaacaggataactgacaggaattgtct
gagttctgaggaattctgaagttcaggaggataactgacagtcgtactgg
ccggtgccttcttgtcgaaggctggatccatcagtcgccttttgagctca
ccgcaccggccgataacaaactccggccgacatatccatcgatgtaccgg
cccaacggagcattgaagccgaacacaccggaatatgttctgcaagttgc
ccaccggcatgctccagcacactatatatacctggccagacacaccagct
gaatccatcagttctccgtcctcatcttccagagcacagctagctagagc
ctagagctcaagatcatggcgaacaaacacatgtccctttctctcttcat
cgtcctccttggcctctcgtgcagcttggcctccgggcaagtcctgtttc
aggtaagaatacgatcttgatcatcttgtccgtcggcaagcgccgtgtcc
ggctcctgggttttgtacgtactcactgagctttgggttctgctgcgttc
gacagggttttaactgggagtcgtggaagcacaatggcgggtggtacaac
ttcctgatgggcaaggtggacgacatcgccgccgctggcgtcacgcacgt
gtggctccccccggcgtcgcagtccgtcgccgagcaagggtacatgccgg
gccggctctacgacctggacgcctccaagtacggcaacaaggcgcagctc
aagtccctcatcggcgcgctccacggcaagggcgtcaaggccatcgccga
catcgtcatcaaccaccgcacggcggagcgcaaggacggccggggcatct
actgcatcttcgagggcggcaccccggacgcgcgcctcgactggggcccc
cacatgatctgccgcgacgaccggccctacgccgacggcaccggcaaccc
ggacaccggcgccgacttcggggccgcgccggacatcgaccacctcaacc
cgcgcgtccagaaggagctcgtcgagtggctcaactggctcaggaccgac
gtcggcttcgacggctggcgcttcgacttcgccaagggctactccgcgga
cgtggccaagatctacgtcgaccgctccgagcccagcttcgccgtcgccg
agatatggacgtcgctggcgtacggcggggacggcaagccgaacctcaac
caggacccgcaccggcaggagctggtgaactgggtgaacaaggtgggcgg
ctccggccccgccaccacgttcgacttcaccaccaagggcatcctcaacg
tggccgtggagggcgagctgtggcgcctgcgcggcaccgacggcaaggcg
ccgggcatgatcgggtggtggccggccaaggcggtgaccttcgtcgacaa
ccacgacaccggctccacgcagcacatgtggcccttcccttccgacaggg
tcatgcagggatatgcctacatcctcacgcacccagggaccccatgcatc
gtgagcgtcatcctaccaatacatcatatcaaaatcttctgttctttttt
ccgttcataacaagaaatcatgaccgaactgatggaaaataattgtgatt
cttcagttctacgatcatttcttcgactggggcttgaaggaggagatcga
tcgtctggtgtcaatcaggacccgacaggggatacacagtgagagcaagc
tgcagatcatggaggccgacgccgacctttaccttgccgagatcgacggc
aaggtcatcgtcaagctcgggccaagatacgatgtcggacacctcattcc
tgaaggcttcaaggtggtcgcgcatggcaatgactatgccgtatgggaga
aagtataaagcaaaattaacggagcggctctacaaattagtccgagctcg
tgttgtccacatagtacgattttagtacttcctccatgtaaaaaaggagg
atgagggacatccattgtatttttcataaataatacaataatcaataagc
attttcgctacccatggtttagtcgatgttcgtttaccacagattgtaac
tccaagctt
BLAST
BLAST Search