Query (optional)   in Class  

GrainGenes Sequence Report: J04954

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J04954
Subsequence
J04954_1.cds245607
J04954_2.cds5981335
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC283572
Data at Gramene
Gramene-Protein P26303
DB Remark
Locus Source: chloroplast Triticum aestivum (bread wheat)
Keyword
NADPH-plastoquinone oxireductase
ndhC gene
psbG gene
thylakoid membrane protein
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum chloroplast NADPH-plastoquinone oxireductase (psbG) and thylakoid membrane protein (ndhC) genes, complete cds.
Remark
DB_xref: taxon:4565
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'genomic DNA';
Gene: ndhC
Gene: psbG
Locus Comment: Original source text: Chloroplast Triticum aestivum DNA.
EMBL Feature
feature_gene234607Location: 234..607
feature_gene5861335Location: 586..1335
RBS234238Location: 234..238
RBS586590Location: 586..590
DNA
agatctacatacaccatatctaaatagaatggaaatccaaaagaaaggga
gttgggattccattggatgaatctttaaagaagatgcagcacagaggaaa
caaaggctaaactaagcgcttttgtttgaacaaaaaagattcttgtttca
ccgaggaaaagagagaagttctggataaattgacaatgctgaattgaatt
gactaatttaagttccgcctattccacattaatgggagtacattatgttt
ctgcttcacgaatatgatattttttggacatttctaataatagcaagcct
tattcctattttggcattttcgatttcaggacttttagccccggttagtg
aaggaccagagaagctttctagttatgaatcgggtatagaacccatggga
ggggcttgggtacaattccgaatacgctattatatgtttgcgctcgtttt
tgttgtttttgatgtggaaaccgtctttctatacccttgggcaatgagtt
tcgacgtattgggtgtatccgtttttatcgaagctttgattttcgtgctt
atcttagttgttggtttagtttatgcatggcgaaaaggagccttggaatg
gtcttaactgaatatttagacaaaaaaaaagaaggaaaagattctattga
gacagttatgaatttgattgagtttcccttacttgaccaaacaagttcca
attctgttatttcaactacaccaaatgatctttcgaattggtcaagactc
tctagtttatggccccttctatacggtaccagttgttgtttcattgaatt
tgcttcattaataggctcacgattcgactttgatcgttatggattggtac
caagatcaagtcctaggcaagcagacctaattttaacagccggtacggta
acaatgaaaatggctccctctttagtgagattatacgagcaaatgcctga
accaaaatacgtcattgctatgggagcctgtactattacagggggaatgt
tcagtacggattcctatagtactgttcggggagttgataagttaattcct
gtggatgtctacttgccgggctgcccacctaaaccggaggcagttataga
tgccctaacaaaacttcgtaagaagatatcgcgagaaatagttgaggatc
gaactctatctcaaaataaaaatagatgttttactaccagtcacaagctt
tatgttaggcgcagtactcatacaggaacttatgagcaagaattgctcta
tcaatcaccatctacattagatatatcttctgaaacttttttcaaatcca
aaagttcagtaccttcctacaaattagtgaattaggaggggggctctttt
gtgtagaaaaataaaaagcagggcaatctttcaaacttgcatccgaaatg
tgaaatatttatacaaagagggagagatgaagacaatgcagcagggttgg
ttatctaattggctagtcaaacatgaggtggttcatagatct
BLAST
BLAST Search