Query (optional)   in Class  

GrainGenes Sequence Report: J05104

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J05104
Subsequence
J05104_1.cds100210
J05104_2.cds540930
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC182559
Data at Gramene
Gramene-Protein P13165
DB Remark
Locus Source: chloroplast Hordeum vulgare subsp. vulgare
Keyword
photosystem I subunit
thylakoid protein
transmembrane protein
Species
Hordeum vulgare subsp. vulgare
Developmental Stage
6 day old seedling
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare photosystem chloroplast I subunit (psaI) gene, complete cds.
Strain
Svaloefs Bonus
Clone
Pst 186
Remark
DB_xref: taxon:112509
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'genomic DNA';
Gene: psaI
Locus Comment: Original source text: Chloroplast Hordeum vulgare (strain Svaloefs; Bonus) (clone: Pst 186) 6 day old seedling DNA.; Draft entry and computer-readable sequence for [1] kindly submitted; by H.V.Scheller, 01-SEP-1989.
EMBL Feature
feature_gene100210Location: 100..210
DNA
aatattccttataatagatatacttaattatatcataagaatcttaagat
atttttcgactagatagaaatagtaaatttgaattgagacacctattcca
tgacggatttaaacttaccttctattttcgtgcctttagtaggcttagta
tttccggcaattgcaatgacttctttatttctttatgtgcaaaaaaaaaa
gattgtctagtattttttagtgtaagtaatataatatggtagggtatgtg
actttttctacacacactttctacacacaaatgaaaaacggctatggatg
cagatataggctacgagcataaatgcatgaatatgcagagcttggtatag
cgagtttttttttatttattttaattgaatcaacgaatattttgaataga
aagtcaatgtatctaacctattatttcacaggagtactagttgctgaagg
cgatttcagaatcaaaaaaagtaaaggcaaaattatttagcttattctct
caatttcaatcgaccgctgctggatttagtatatctaatatgaattggcg
atcagaacacatatgggtagaacttctaaaaggttctcgaaaaaggagta
attttttctgggcctgtattctttttctaggttcactaggattcttattg
gttgggacttccagttatcttggtaagaatattatatctatacttccatc
tcaagaaattcttttttttccgcagggggtcgtgatgtctttctacggaa
tcgcaggcctattcattagctcctacctgtggtgtactattttgtggaat
gtaggtagtggttatgaccgattcgatagaaaagagggaatagtttgcat
ttttcgttggggattccctggaataaaacgtcgcgtcttccttcgattcc
ttatgcgggatatccaatcaattagaattc
BLAST
BLAST Search