Query (optional)   in Class  

GrainGenes Sequence Report: J05485

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J05485
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein P14812
DB Remark
Locus Source: Avena sativa (oat)
Keyword
12S globulin
storage protein
Species
Avena sativa
Data Source
genbankRelease 141, Apr 15 2004
Title
A.sativa 12S globulin seed storage protein gene, complete cds.
Remark
DB_xref: taxon:4498
[ Show all 7 ]
EMBL Feature
TATA_signal917921Location: 917..921
[ Show all 13 ]
DNA
gaattctttttggaaagtcattttgcctcctgaactccagtgtttcctat
ttattaaaaaaaactaaaaactatatttataagtttgaaaaaatcatgaa
acaaaattgtaaaaattgctagtgatatatcccacaaacgtgcaaaatct
caatttgaagtgctttgtatttcgagctacacaaaaatgacaaagtgtga
ctttttatgtgatttgaaatcactatactacagatctacaattttgttct
ttttgtgaagctataaatacacattattttgagttgagatttttcatgtt
tgtgctatgaatcataggctacatcctgatttatttttagaattttttgg
aacctaaaatatgttctagattattttttaaaaagtgggatcattgatgc
ccatacacacgaaatctccactcaattcttttatacattatctttctata
tctactaacgtggattatacatcatagtaagtttcttactacatgtgctt
tcttgttacaatgtggacatgactcttccacttttgggctttatgttgta
tggatatactcatgacatggaattttgtccacacacgtagaaccatccat
atatattgttgtgcatagaacaaaacacaagcaagccatgaaaaaggagt
cacaggtgccacaaactgttgtaggaagtataactagtatgaggcctttt
atttgacgtcggacaatggccaagagctacatataaaagatggtgctaga
tttgtgagtcagcaccagctgtaggcagaaaacaacacatatcttttgag
acaaagttatatctattcacatttaaaaccatgatctgttgagtcaccat
gaatatcttcttatctatgttaataattacatgtcatcatgtttatcctg
gactactttttatggctataaaatcaaacttacaataaggaaactagcac
caatccaccttctacaatctcttcaaacaatcatggcaactactaggttt
ccatcattgttgttttactcctatatttttctcttgtgcaatgggtcaat
ggctcagctattcgggcagagctttaccccatggcaaagctctcgacaag
gaggtttaagggggtgcagatttgataggctacaagcatttgaaccactt
cgacaagtggggtcacaagcgggtatcattgagtactttgatgagcagaa
tgagcaatttcgttgtgcaggtgtatccgtcatccgtcgtgttattgagc
ctcaaggcctcttgttacctcaataccacaacgctcctggcttggtgtac
atccttcaaggttagtgtctaattgattataaaaattgcctttgttatac
ttcacttaggatttagatgtgccaaatgttacaccgttcatattttttaa
caatgaaacaaatgtgttttcttttaggtaggggattcacagggttgact
ttccctggatgcccggcgaccttccaacaacagttccaaccatttgatca
agcccagtttgctgaaggtcaaagccaaagccaaaatcttaaggatgaac
accaaagagttcaccacatcaaacaaggagatgttgttgctctaccggct
ggcatagtacactggtgctacaacgatggtgatgcaccgattgtagctgt
ctatgtcttcgacgtaaacaacaacgctaatcagcttgaaccaaggcaaa
aggtaactatacaacttaatgcacacaaaatatatacaactatttacaag
tgatccaactatgatttgaagtatacattagtgggatattaatgaactct
gtttaacttcatcgatataaaattttaggagttcttgttggctggtaaca
acaagagagagcaacagtttggacaaaacatattcagtggattcagtgtc
caacttcttagtgaggcccttggtataagtcagcaagtagcacaaaagat
tcagagtcaaaatgaccaaagaggtgagataattcgtgtgagtcaaggcc
ttcaattcttgaagccttttgtttcccaacaaggaccagtagagcatcaa
gcctaccaaccaattcaaagtcaagaagaacaatcaacccaataccaggt
agggcaatcaccacaatatcaagaaggacaatcaactcaataccagccag
gacagtcatgggaccaaagtttcaatggtttggaggagaatttctgttca
ttggaggcaaggcaaaacatcgaaaacccgaaacgtgccgacacgtacaa
cccacgtgctggcaggataacacatctcaatagcaagaattttcccaccc
ttaacctggtgcaaatgagtgctacaagagtaaatttataccaggtattt
atgatactacattcaacacactatcttatttttagatattctaagcttca
tacaaccgattaataatatggcatacaaataattgctattgcagaatgct
attctttcaccatactggaacattaatgctcacagtgtcatgcacatgat
ccaaggacgtgctcgagttcaagttgtcaataaccatggtcagaccgtat
tcaatgacattcttcgtcgcggacaactgctaatcataccacaacactat
gttgttctcaagaaggcagagcgtgaaggatgccagtatatttcattcaa
gaccaaccccaattccatggttagccagatcgcaggaaagacctccatcc
tacgtgcattgcccgttgatgtcctcgccaatgcataccgcatttctaga
caggaagcccaaaacctcaaaaataaccgtggagaagagtttgatgcatt
cacccctaagtttacacaaacgggctcccagagttaccaggacgaggggg
agtcatcttcgactgagaaggcatccgagtgaataagtgagtgtaatgga
aactagtatagtgaaataaaggcatcgcatgtttgcagcctagtggtata
taaccgcttatctcaataaaaaagtttctccgtgttatattgtttgcttg
tttcttgtactcttcttaattttatcttttatgatcaaccaacttacctc
tcttcttcaattttctgccactcttcacatatgcatatcaaggagacgta
tagtccacttgtactagatttattttttggtactatcttttgtggtttga
gtatttcttaggtccgataaaaacattcaatttactgatgctaaattttt
tcagcaaacctagccacctaaaattgtgaatcacataccttcaaatttct
atgccaaagtgtgcgatttttatgttctatagatccaagcttgggctgca
ggtcgactctagaggatcgatccccgggcgagctcgaattc
BLAST
BLAST Search