Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c1011_280

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Jagger_c1011_280
Contig
7DL_3343962
Species
Triticum aestivum
Probe
Jagger_c1011_280
DNA
ATGACCTACATGTTCAAGTACGACACCGTTCACGGCCACTGGAAGCACAG
YGACATCAAGCTCAAGGACGACAAGACTCTGCTCTTTGGCGAGAAGCCAG
T
BLAST
BLAST Search