Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c10124_91

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Jagger_c10124_91
Contig
2DL_9894863
Species
Triticum aestivum
Probe
Jagger_c10124_91
DNA
cctgcttcaatgaatctctcagcaaggatagcattttggcaggtaaattc
Rcccacaagtggaaacctgagctgcttaaagactccaggcactggagaag
a
BLAST
BLAST Search