Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c10146_150

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Jagger_c10146_150
Contig
3B_10584087
Species
Triticum aestivum
Probe
Jagger_c10146_150
DNA
TGATCCTGCCCCTCTATTCATTCACCCTCTTCTGCGTCATACTTCCAATG
RCAATGTTTGCTCCTGAAGCAGAGCTACCTGCCTGGGTGGTGTGCTACAT
T
BLAST
BLAST Search