Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c1015_123

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Jagger_c1015_123
Contig
6AL_5745289
Species
Triticum aestivum
Probe
Jagger_c1015_123
DNA
TACAACAGAAGGCAAGAGCTGGACTTCTTCGGCGAGATATCTGGGATGTC
YTTCAGCCCCGACACAGACGCCCTCTTCGTCGGCGTGTGGGATAGAACAT
A
BLAST
BLAST Search