Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c10169_255

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Jagger_c10169_255
Contig
4BS_4926042
Species
Triticum aestivum
Probe
Jagger_c10169_255
DNA
GGGATTCAGTTAATTCAAACCCGTTCTAACAGGCGGGAAACGCCAGAAGC
YACACATCTTCGATCGCACGGCCGAGACGACGTCGTACCGTTTCGCCAGT
T
BLAST
BLAST Search