Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c10182_85

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Jagger_c10182_85
Contig
4DL_14313168
Probe
Jagger_c10182_85
DNA Homology
4DL_14313168Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-444DL_14313168Best IWGSC match
DNA
aactccgcgtcaagcgtgtccaagtcccatgccgtggccaaatagccata
Raggacccatgtcggttcgcccttctcatccaccttgacaaacatggggt
t
BLAST
BLAST Search