Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c10188_98

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Jagger_c10188_98
Contig
2BL_8054795
Probe
Jagger_c10188_98
DNA Homology
2BL_8054795Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-422BL_8054795Best IWGSC match
DNA
atggggatcagcctcgatgcaccaaaatccgagacctttgcggtgtagct
Rtcattcaggagcacgttcatggacttgacatctctatggaggaccgaca
c
BLAST
BLAST Search