Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c10189_75

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Jagger_c10189_75
Contig
4BL_7041386
Species
Triticum aestivum
Probe
Jagger_c10189_75
DNA
attagcttaaatcccccaccgagaatagaggctgggaggtaaggtagccg
Ratctgccagtctactcacaccatacaagtaagtagcaacaccagacagg
a
BLAST
BLAST Search