Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c1027_169

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Jagger_c1027_169
Contig
1DL_2292282
Species
Triticum aestivum
Probe
Jagger_c1027_169
DNA
TAGTAGTGGTTTGCTGTAGTAGTGTATGTGTATGATTTACGATGGAAGGG
RAGCAGATGTAAACGCTCTCCCTTCGTCGATTCATCATRCATTTGATACG
Y
BLAST
BLAST Search