Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c1031_465

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Jagger_c1031_465
Contig
4DL_14422381
Species
Triticum aestivum
Probe
Jagger_c1031_465
DNA
AGCAGCTAATAATTAAAGTTCGTGAGATTTTGACAGACAAAGAATGGCGT
Mggaggaaaatgcagatgaggatatcagaggaagaaggaagactgaagaa
g
BLAST
BLAST Search