Query (optional)   in Class  

GrainGenes Sequence Report: Jagger_c1036_447

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Jagger_c1036_447
Contig
2AL_6426440
Species
Triticum aestivum
Probe
Jagger_c1036_447
DNA
TCATCATCCTCATCTTGCCATTTATCCCAGTCAACCTTCAGGAACACAGG
YGGCCTACCTTCCTTCTTGAGCAGCCTAGGCCACCACTTGSCCTCAGCTT
T
BLAST
BLAST Search