Query (optional)   in Class  

GrainGenes Sequence Report: L06607

Sequence
L06607
Subsequence
L06607_1.cds65310
L06607_2.cds391458
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC189735
Data at Gramene
Gramene-Protein O03060
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Keyword
NADH dehydrogenase
photosystem I subunit C
Species
Hordeum vulgare subsp. vulgare
Cultivar
Svalofs Bonus
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare photosystem I subunit C (PsaC) gene, complete cds; NADH dehydrogenase (ndhD) gene, complete cds.
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'genomic DNA'; tissue_lib = 'pBR325'
Gene: PsaC
Gene: ndhD
Locus Comment: Original source text: Hordeum vulgare (cultivar Svalofs Bonus); (library: pBR325) DNA.
EMBL Feature
feature_gene65310Location: 65..310
feature_gene391458Location: 391..458
DNA
agtactaattttctttttaccagatcgaaaaattttatgttgaaaagaaa
aatttatagatccaatgtcacattccgtaaaaatttatgatacatgtata
ggatgcactcaatgtgtacgagcttgtccaacagatgtattagaaatgat
accctgggatggatgtaaagccaagcaaattgcttccgcgccgagaaccg
aagattgtgtgggttgtaagagatgtgaatctgcctgcccgacagatttt
ttaagtgtccgcgtttatttagggcctgaaacaacccgtagcatggctct
atcttattgatacgttacaaaaacaaaaaacttcatttgaatcgtctgat
tcctctttaccgaagaagcctgtgctcgaaataatcgagcacgggctttt
ctggtcaaaacgtatcttgtctttatcactttatcatgagttattttcct
tggttaac
BLAST
BLAST Search