Query (optional)   in Class  

GrainGenes Sequence Report: L07604

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L07604
Subsequence
L07604_1.cds104709
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277236
NCBI UniGene
Ta.94
Data at Gramene
Gramene-Protein Q02879
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'TFIID mRNA encoding DNA binding protein'
Keyword
DNA-binding protein
Species
Triticum aestivum
Developmental Stage
seedling
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum DNA-binding protein (TFIID) mRNA, complete cds.
Remark
[ Hide all but 1 of 6 ]
DB_xref: taxon:4565
Feature: 5'UTR: gene = 'TFIID'
Feature: 3'UTR: gene = 'TFIID'
Feature: source: mol_type = 'mRNA';
Gene: TFIID
Locus Comment: Original source text: Triticum aestivum hermaphrodite seedling cDNA; to mRNA.
EMBL Feature
feature_gene11154Location: 1..1154
5_UTR1103Location: 1..103
3_UTR7071138Location: 707..1138
DNA
tctcttccccgcgggagaatcccgcggctcctcctccctcggcgcgcccg
gaccggcgtcctcccgcggggccggggggcggcggcgggggcgacggcgg
tggatggcggaggcggcggcgctggaggggagcgagccggtggatctgac
caagcacccctccggcatcatccccacgctccagaatattgtgtcgacgg
tcaacctggactgtaagttggacctgaaagcaatagctctccaggcacgc
aatgcagagtataaccccaagcgttttgctgcagttatcatgcggataag
agaaccaaaaactaccgcattgatatttgcttcaggaaaaatggtttgca
ctggagcaaaaagtgaacaacaatctaaactcgcagctagaaagtatgct
cgtataattcagaagcttggatttcctgcaaaattcaaggacttcaagat
ccagaatattgttgcctcttgtgatgtcaaattccctatcaggcttgagg
gcctcgcatattcccatggcgctttctcaagttatgagccagagctattt
cccggtctgatttaccggatgaggcagccgaagattgtcctcctaatttt
tgtttctggcaagattgttctgactggagcaaaggtgagagaagagacat
actccgccttcgagaacatatatcctgtcctgacagagttcagaaaagtc
cagcaatgatggtgactttggaagtaaagcagaattggagacattgttgc
ttgctgccagctccaacctcgcaaagtctaggcatagcccgtcttccggt
ggaaaaccctatatatatatatactgtccatcagatttggagtacctgtt
gtcgtaatcgactagggttcttctttttgtgatggatcatggttgatcat
cgcaggtatcatcgcaggtctattctgtcatggcatcgtccctcactcga
aacactcttgtggaagttgagtgaaacccaagcaaattttgctcctggat
tctagagcctttttctcctgatgatgtgatgatgaaaacgccagctgatg
tatattcacttgtagacgcgtttgcgccctgttaaaaggagggcttcatg
tcgagccgaatagcaagaggaaaatttgtgttatttctaaaaaaaaaaaa
aaaa
BLAST
BLAST Search