Query (optional)   in Class  

GrainGenes Sequence Report: L02368

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L02368
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Lophopyrum ponticum
Species
Lophopyrum ponticum
Data Source
genbankRelease 135, Apr 15 2003
Title
Lophopyrum ponticum repeat region sequence.
Remark
DB_xref: taxon:4589
Feature: source: mol_type = 'genomic DNA';
Note: submitted as Thinopyrum elongatum
EMBL Feature
repeat_region1419Location: 1..419
DNA
gtcancccgtctccacatcactcgccatgaaggcacncncgggtacccct
caggccgacccgtctttagtaacaagtaacagtgtcaaatcatagtatcc
atagtaacagcagggtcctggtcttcgatcccgatggtcgggtcttctga
atctccagcggggcnntcgggataagtngggtctcctatggtctctaccc
aacctagactaagcagtttaggataagcagtaggtaacaagcaggttaca
ataaacangctatgcatcagaataggtaaaacagtagcagncancaattc
taatgcaagcatgagagagaagagaatgggcnatatcggaatgctcaaaa
agggggngcttgcctgtctgcttgacggnaaaggcagggncttcgatggt
gaagcagncgactctagag
BLAST
BLAST Search