Query (optional)   in Class  

GrainGenes Sequence Report: L07941

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L07941
Subsequence
L07941_1.cds117809
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC281622
NCBI UniGene
Ta.162
Data at Gramene
Gramene-Protein Q43209
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'L-isoaspartyl methyltransferase'
Keyword
L-isoaspartyl methyltransferase
Species
Triticum aestivum
Cultivar
Augusta
Developmental Stage
48 hour etiolated seedlings
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum L-isoaspartyl methyltransferase mRNA, complete cds.
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA'; tissue_lib = 'lambda ZAP'
Locus Comment: Original source text: Triticum aestivum (cultivar Augusta); (library: lambda ZAP) 48 hour etiolated seedlings cDNA to mRNA.
DNA
cgtcccgcttcctgttgccctccacggccgcccgccgccggttcctccac
cacctcctcgccgcgcccgcgcccccgaggccgccgcagcttcggcgctg
ctccccgtaccactggatggcgcaattttgggctgaaggatcactggaga
agaacaacgctctggttgaatacctgaaacagtatggtgttgttcgaacc
gataaagtggcagaagttatggaaactatcgaccgagccttatttgtacc
ggagggctttaccccttacaccgacagtcctatgcctattggttacaatg
caacaatatctgctcctcacatgcacgcaacctgcttagaactgttgaag
gattatttacagccaggcatgcatgctctggacgttggatcaggcagtgg
ttacttgactgcttgctttgcaatgatggtcggaccagaaggtcgcgcag
tggggattgaacacattcctgaactcgttgttgcttctactgaaaatgtc
gaacggagtgctgcagcagcactaatgaaggatggttcactttcttttca
tgtttcagatggaaggcttggctggccggatgcggcgccatacgatgcta
ttcatgtgggcgcagcggcacctgagatccctcggccactgctggagcag
ctgaagcctggcgggcggatggtcatacccgttggcacatactctcagga
cctgcaggtgattgacaagagcgccgacggatccaccagcgtccgcaacg
atgcctctgttcgctacgtccctctgaccagccgctctgctcagctgcag
gacagctgagatccttcgctctggatctggaaatgtgtgtgtatatatgt
gagtgccgatgatctttgtctaccaatgtggcgtctgatgttttagatgg
tttggttttgtataatgcttactgctggttgatgttgctt
BLAST
BLAST Search