Query (optional)   in Class  

GrainGenes Sequence Report: L08060

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L08060
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
NCBI UniGene
Ta.14227
Data at Gramene
Gramene-Protein P47815
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Initiation factor 1A (eIF-1A) mRNA'
Keyword
initiation factor 1A
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
Wheat initiation factor 1A (eIF-1A) mRNA.
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Triticum aestivum cDNA to mRNA.
EMBL Feature
polyA_site551551Location: 551
DNA
ggcacgaggcgagctggtgttcaaggaggacgggcaggagtacgcgcagg
tgacgcggatgctcggcaacgggcgctgcgaggccatctgcgtcgacggc
accaagcgcctctgccacatccggggcaagatgcacaagaaggtctggat
cgccgccggggacatcgtcctcgtcggcctccgcgactaccaggacgaca
aggccgacgtcatcctcaagtacatgaacgacgaagcccgcctgctcaag
gcttacggggagctccccgacaccgtccgcctcaacgagggcgtcgacgt
cgacggccccgaggagggcgagggcgacagcgactacatccagttcgagg
acgaggacatcgacaagatctaagcttttttcccctcctcctccctcgct
cgatatactttgtgttctattctgttctaatagcgtccgtgtctgtctgt
gtcggtcggtcggtgggctgttgtggattgatggatttggtaacgagaaa
tcgttgtgatttgaggtgcttaaataattgtcggattatagtgttcgtcg
t
BLAST
BLAST Search