Query (optional)   in Class  

GrainGenes Sequence Report: L10332

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L10332
Subsequence
L10332_1.cds128898
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein Q7GI75
DB Remark
Locus Source: Triticum timopheevii
Keyword
open reading frame
Species
Triticum timopheevii
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum timopheevii mitochondrion open reading frame (ORF256), complete cds.
Remark
DB_xref: taxon:4570
Feature: source: mol_type = 'genomic DNA'; tissue_lib = 'TA103'
Locus Comment: Original source text: Triticum timopheevi (library: TA103) DNA.
EMBL Feature
5_UTR1127Location: 1..127
3_UTR899936Location: 899..936
DNA
ccaagaagttcccgaaacttggtttagtattaaggttcttctcttccagc
gtttagtattcaagttcttctcttccagccccccggcccctctttgataa
ggaaagtttgcatttctcaaataaaaaatgacaaatatggttcgatggct
cttctccactagcaggtttactgctttctatttgcacttttgtattaagt
ttccttatatatacgattttttattattttctatttgtctatttttcttt
ttagtgcgttttatttcgattattcttctcccaatttgcaatcttttcgg
agcctccttcattattactcttcctccagagattcaggatccccaagctc
tagctcatttagcagggctaaacttctatctgagcctttacgagcaggat
cctggatgggttacgttcattcagaacgagcttaatcacaatacccctct
ggaggacatacctggacggcttaagctcttcctaatggaagaaaagctgt
ctagtatgcgacaagatgtcattcaggaatttgtggcgctttatcaaaga
atagggccttatctaccgatcgagccctacttggtcgatgaagcgcttcg
ttcctatctggaccatattcacgcaactgattctttcactgttctccaag
cgtcttatcaagatctgcgggagaatgagggaggatctgttttctttaga
gatgctgtttcccacaaccgggatctccttgaggcggaaagctccgcaag
gaggtgcctggaagtggaacagaggatccgatgggaagaaatccccaaga
gcaaggcaagtctcgaaagagctgagcacgagcatgctctcgacttgttt
aagtcggaggatcttagaagggaattagaaaaaaaaagagcggggtagct
cagtaattctgattcttttctcttccagcccccggg
BLAST
BLAST Search