Query (optional)   in Class  

GrainGenes Sequence Report: L10364

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L10364
Subsequence
L10364_1.cds87857
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein Q04315
DB Remark
Locus Source: mitochondrion Triticum aestivum x Triticum timopheevi
Species
Triticum aestivum x Triticum timopheevi
Tissue
shoots
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum x Triticum timopheevi unknown mRNA; mitochondrial gene for mitochondrial product.
Strain
WA17717 (male sterile)
Remark
DB_xref: taxon:4566
Feature: source: organelle = 'mitochondrion'; mol_type = 'mRNA';
EMBL Feature
5_UTR186Location: 1..86
3_UTR858895Location: 858..895
DNA
tcttccagcgtttagtattcaagttcttctcttccagccccccggcccct
ctttgataaggaaagtttgcatttctcaaataaaaaatgacaaatatggt
tcgatggctcttctccactagcaggtttactgctttctatttgcactttt
gtattaagtttccttatatatacgattttttattattttctatttgtcta
tttttctttttagtgcgttttatttcgattattcttctcccaatttgcaa
tcttttcggagcctccttcattattactcttcctccagagattcaggatc
cccaagctctagctcatttagcagggctaaacttctatctgagcctttac
gagcaggatcctggatgggttacgttcattcagaacgagcttaatcacaa
tacccctctggaggacatacctggacggcttaagctcttcctaatggaag
aaaagctgtctagtatgcgacaagatgtcattcaggaatttgtggcgctt
tatcaaagaatagggccttatctaccgatcgagccctacttggtcgatga
agcgcttcgttcctatctggaccatattcacgcaactgattctttcactg
ttctccaagcgtcttatcaagatctgcgggagaatgagggaggatctgtt
ttctttagagatgctgtttcccacaaccgggatctccttgaggcggaaag
ctccgcaaggaggtgcctggaagtggaacagaggatccgatgggaagaaa
tccccaagagcaaggcaagtctcgaaagagctgagcacgagcatgctctc
gacttgtttaagtcggaggatcttagaagggaattagaaaaaaaaagagc
ggggtagctcagtaattctgattcttttctcttccagcccccggg
BLAST
BLAST Search