Query (optional)   in Class  

GrainGenes Sequence Report: L11581

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L11581
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum monococcum
Keyword
8S ribosomal RNA
ITS
internal transcribed spacer
Species
Triticum monococcum
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum monococcum 5.8S ribosomal RNA gene.
Gene Product
5.8S ribosomal RNA
Remark
DB_xref: taxon:4568
Feature: misc_RNA: product = 'internal transcribed spacer 1'; function = 'internal transcribed spacer region'
Feature: misc_RNA: product = 'internal transcribed spacer 2'; function = 'internal transcribed spacer region'
Feature: source: mol_type = 'genomic DNA';
Locus Comment: Original source text: Triticum monococcum leaf DNA.
EMBL Feature
misc_RNA1223putative
misc_RNA388603putative
rRNA224387putative
DNA
tcgtgaccctgaccaaaacagaccgtgcacgcgtcatccaatccgtcggc
gatggcattgtccgtcgctcggccaatatgcctcgaccacctcccctcct
tggagtgggtgggggctcggggtaaaagaacccacggcgccgaaggcgtc
aaggaacactgtgcctaacccgggggcatggctagcttgctagccatccc
ttgtgttgcaaagctatttaatccacacgactctcggcaacggatatctc
ggctctcgcatcgatgaagaacgtagcgaaatgcgatacctggtgtgaat
tgcagaatcccgcgaaccatcgagtctttgaacgcaagttgcgcccgagg
ccactcggccgagggcacgcctgcctgggcgtcacgccaaaacacgctcc
caaccccctcatcgggaatcaggatgcggcatctggtccctcgtctcgca
aggggcggtggaccgaagatcgggctgccggcgtaccgcgccggacacag
cgcatggtgggcgtcctcgctttatcaacgcagtgcatccgacgcgcagc
cggcatgacggcctcaaaatgacccagcaaacgaagcgcacgtcgcttcg
acc
BLAST
BLAST Search