Query (optional)   in Class  

GrainGenes Sequence Report: L11740

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L11740
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
NCBI UniGene
Hv.22866
Data at Gramene
Gramene-Protein P34824
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'CDNA clone: FLbaf147p10, mRNA sequence'
Keyword
elongation factor
elongation factor 1-alpha
Species
Hordeum vulgare
Tissue
primary leaf, etiolated
Developmental Stage
8 day old seedlings
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley elongation factor 1 alpha, (EF-1A) mRNA sequence.
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Hordeum vulgare 8 day old seedlings primary; leaf, etiolated cDNA to mRNA.
DNA
gaattccgttgctgtcgatacgactcactatagggagaccggaattccgt
tgctgtcgcgccgccccccctcctcttcgtctccggccagccaggtagtt
aacagccatgggcaaggaaaagatccacatcagcattgtggtcattggcc
atgttgactctggcaagtcaaccacgactggccatctcatctacaagctt
ggaggcattgacaagcgtgtgatcgagaggtttgagaaggaagccgctga
gatgaacaagaggtcattcaagtatgcctgggtgcttgacaagctcaagg
ctgagcgtgagagaggtatcaccattgatattgctctgtggaagttcgag
accaccaagtactcttgcactgtcattgatgctcctggtcaccgtgattt
catcaagaacatgatcactgggacctcccaggctgattgtgctgtgctta
tcattgactccaccactggtgtttttcaggctggtatctccaaggatggc
cagacccgtgagcatgctctccttgctttcactcttggtgtgaagcagat
gatttgctgctgtaacaagatggacgccaccactcccaagtactcgaagt
cccgttacgatgaaattgtcaaggaagtctcttcatacctgaagaaggtc
ggctacaaccctgacaaggtccccttcgttcccatctctgggtttgaggg
tgacaacatgattgagaggtcctccaaccttgactggtacaagggcccta
ccctgcttgaggcgcttgaccagatcaatgagcccaagaggccctcagac
aagcccctgcatcttccccttcaggatgtctacaagattggtggcattgg
aactgtgccagtgggacgtgttgagactggagtcatcaagccaggcatgg
ttgtcacctttggccctactggcctgaccactgaggtcaagtctgttgag
gtgcaccatgagtctctcctggaggcgcttcctggtgacaatgttggctt
caacgtcaagaacgtggctgtcaaggatctcaagcgtgggtatgttgctt
ccaactccaaggacgaccctgccaaggaggctgccaacttcactgcccag
gtcatcatcatgaaccaccctggccagatcagcaacggttatgcccctgt
gctggactgccacacatcccacatcgccgtcaagttcgccgagatccaga
ccaagatcgacaggcggtccggcaaggagctggaggcagcgcccaagttt
ctcaagaatggtgatgctgggttcgtcaagatgattccaaccaagcccat
ggtggtggagacctttgcccagtaccctcctctgggtcggtttgccgtgc
gtgacatgaggcagacggttgctgtgggtgtgatcaagagcgtggagaag
aaggagccgaccggcgccaaggttaccaaggctgcgatcaagaagaaatg
agatggtgtcaggttctttaccacatctatggtggcggtggcggtgtttg
gtggtggcgatagttgttttagtcgcttgggttatttgtgtcgagaagtg
tttgaactgcttaaagctctggtcattgtatcgttcggttgtgttggtgg
aacttcatcagttaatgttgctaccatatatagtcatcatgtttggagtc
gttttatatcaaaaaaaaaaaaccgttgctgtcgcgacagcaacggaatt
cgagctcggtacccggggatcctct
BLAST
BLAST Search