Query (optional)   in Class  

GrainGenes Sequence Report: L11862

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L11862
Subsequence
L11862_1.cds801546
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC163537
NCBI UniGene
Hv.283
Data at Gramene
Gramene-Protein Q40078
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Vacuolar ATPase B subunit'
Keyword
vacuolar ATPase B subunit
Species
Hordeum vulgare
Tissue
root
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare vacuolar ATPase B subunit isoform mRNA, complete cds.
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Hordeum vulgare cDNA to mRNA.
EMBL Feature
repeat_region118putativeLocation: 1..18
repeat_unit16Location: 1..6
5_UTR179putativeLocation: 1..79
3_UTR15471923Location: 1547..1923
DNA
ctccacctccacctccacctccctctcctcgccgtctcccaccgacccca
acccgaggttgcgcttcgttgggttcagcatgggtctggtgaaggagggc
gccgacatggaggagggaaccctggagatcggcatggagtacaggacagt
ttctggtgtggcaggacctctggttatcttggacaaagtaaagggcccaa
aataccaggagattgtaaacatccgattgggagatggcaccactcggcgt
ggtcaagttctggaagttgatggtgaaaaggctgttgtgcaggtcttcga
aggcacttcaggaatagacaacaaatacacaactgttcagttcacaggcg
aggtcctgaaaactcctgtatcgcttgatatgcttggacgtatttttaac
ggctctggaaaacctattgataatggccctccgatattgcctgaggccta
cttggatatctccggaagttctattaacccaagtgagagaacctacccag
aggagatgattcaaacagggatatctacaattgatgtcatgaactccatt
gctcgagggcaaaagattcctctcttttctgctgctggtcttcctcataa
tgaaattgctgctcagatttgtcgtcaggctggtcttgtcaagaggctgg
agaaaggaaagcacgcagagggtggtggtgaagatgacaattttgctatt
gtgtttgctgctatgggagtgaacatggagacagcccaattcttcaaacg
tgattttgaagagaatggttcaatggagagggtcacccttttcctgaact
tggcaaatgatcccacgatcgaacgtattatcacccctcgtattgcgcta
acaacagcagaatatttggcatatgaatgtgggaagcacgttcttgtcat
cttgacagatatgagttcatatgcagatgcacttcgtgaggtatcagcag
cccgagaagaggtgccaggtaggcgtggttatcctggatatatgtatact
gatctggcaaccatttatgagcgtgccgggcgtattgaaggaagaacggg
ctccattacccaaatacccattctgactatgcctaatgatgacatcacac
atccaactcctgatctcacggggtacattactgaaggacaaatatacatt
gacagacagctccataacagacagatatacccacccatcaacgtccttcc
atctctctctcgattgatgaagagtgctattggtgagggtatgacccgtc
gagaccattcagatgtgtctaatcagctttatgccaactatgctattgga
aaggatgtccaggccatgaaagcagttgtgggagaggaggctctctcttc
tgaagatctgctttatctagaattcctggacaaatttgagaggaaattcg
tagcacagggagcatacgatactcggaacatcttccagtcacttgaccta
gcatggacattgcttcgcatcttccctcgcgagctgctccaccgtatccc
cgcgaagactttggatgcgttttacagcagagatgctgcccactgatcga
tctcatctttgttgggagatccaatgttttctcaagtgcagcttgaataa
attgagcagttcaaacttctggcctttttgctgtagttattattatagtc
agatcccattcttttcgagtcagcgagcataagttatttgtagatttctt
ggtcatggcgtcttttgtaatattgtctcgtgtaatatcacctcctgtat
tgttgaaccaaagcacttgagctcttttttggttccacttcccagaactg
ttagcaagagcatcctaggccaagatgctcgaacacgctggttgtatcta
cttttgtgtatgaataaagatggggcaataaaccgtgctggactgcacgt
gctggtgtacattgttaaaaaaa
BLAST
BLAST Search