Query (optional)   in Class  

GrainGenes Sequence Report: L11872

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L11872
Subsequence
L11872_1.cds191476
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC296379
NCBI UniGene
Ta.1258
Data at Gramene
Gramene-Protein P32112
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'S-adenosyl-L-homocysteine hydrolase'
Keyword
S-adenosyl-L-homocysteine hydrolase
Species
Triticum aestivum
Cultivar
Warigal
Tissue
root-tip
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum S-adenosyl-L-homocysteine hydrolase (SH6.2) mRNA, complete cds.
Remark
DB_xref: taxon:4565
[ Show all 7 ]
EMBL Feature
polyA_site17081708Location: 1708
feature_gene11708Location: 1..1708
5_UTR118Location: <1..18
3_UTR14771708Location: 1477..1708
DNA
aatccaccaaccttctccatggcgctctccgtggagaagacctcgtcggg
ccgggagtacaaggtcaaggacctcttccaggccgacttcggccgcctcg
agctcgagctcgccgaggtcgagatgcccggcctcatggcctgccgcacc
gagttcggcccctcgcagcccttcaagggcgcccggatctccggctccct
ccacatgaccatccagaccgccgtcctcatcgagaccctcaccgccctcg
gcgccgaggtccgctggtgctcctgcaacatcttctccagccaggaccac
gccgccgccgccatcgcccgcgactccgcggccgtcttcgcctggaaggg
cgagaccctcgaggagtactggtggtgcaccgagcgctgcctcgactggg
gcgtcggcggcggccccgacctcatcgtcgacgacggcggtgacgccacg
ctgctcatccacgagggcgtcaaggccgaggaggagttcgagaaatccgg
caaggttcccgacccggagtccaccgacaaccccgagttcaagatcgtcc
tcaccatcatccgcgacgggctcaagaccgacgccagcaagtaccgcaag
atgaaggagaggctcgtcggtgtctccgaggagaccaccaccggcgtcaa
gaggctctaccagatgcaggagtccggcaccctcctcttccccgccatca
acgtcaacgactccgtcaccaagagcaagtttgacaacctttacggttgc
cgtcactcgctccctgatggtcttatgagggccactgatgttatgatcgc
cggcaaggtcgccgtggtctgcggttacggtgatgttggcaagggctgtg
ccgccgcactcaagcaggctggtgcccgtgtgatcgtgacagagattgac
cccatctgtgcccttcaggccctgatggagggtatccagatcctcacctt
ggaggatgttgtctctgaggctgacatctttgtgaccaccaccggaaaca
aggacatcatcatggtcgaccacatgaggaagatgaagaacaacgccatt
gtctgcaacattggtcactttgacaatgagatcgacatgaacggccttga
gacctaccctggtgtcaagcgcatcaccatcaagccccagactgaccgtt
gggtcttccccgagaccaagactggcatcattgttcttgctgagggtcgt
ctgatgaaccttggatgtgccactggccaccccagctttgtcatgtcctg
ctcattcaccaaccaggttattgctcagcttgagttgtggaacgagaagg
ccagtggcaagtatgagaagaaggtgtacgttctccccaagcacctcgac
gagaaggtcgcggccctccacttgggcaagctcggcgccaggctgaccaa
gctcaccaagtcccagtctgactacattagcatcccaattgagggtcctt
acaagctgcggctttaccggtactagtgtgtccagcatgactagcggctg
gcctgagcctgagtcggagcagcggcaccaacgggaactctatcaactat
cctgtttcccttctattatcttacatgctgtctcttaggcggaggatttg
ttattatggttatgttttgagccttgtgagggttgggagaggcggcgttt
gcttttgcccagaaataatggcattattattggtttaagtgaggaggtgt
gcttttcc
BLAST
BLAST Search