Query (optional)   in Class  

GrainGenes Sequence Report: L11873

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L11873
Subsequence
L11873_1.cds501501
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC161456
NCBI UniGene
Hv.3963
Data at Gramene
Gramene-Protein Q40079
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Vacuolar ATPase B subunit'
Keyword
vacuolar ATPase B subunit
Species
Hordeum vulgare
Tissue
root
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare vacuolar ATPase B subunit mRNA, complete cds.
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Original source text: Hordeum vulgare cDNA to mRNA.
EMBL Feature
repeat_region216Location: 2..16
repeat_unit26Location: 2..6
5_UTR149putativeLocation: 1..49
3_UTR15021778Location: 1502..1778
DNA
acccaacccaacccaaggttgttcgtcgccagcatggatctggcgaagga
tggcgccggagatggaggaggggacattggagatcggcatggagtatagg
actgtctccggtgtggcagggccgttggttattttggacaaagtaaaggg
cccaaagtatcaggagattgtgaacatccgattgggagatggcaccactc
gtcgtggtcaagtcctcgaagttgatggtgaaaaagctgttgtgcaggtc
tttgaaggtacttcgggaatagacaacaagtatactactgtgcagtttac
aggcgaggttttgaaaactcctgtctcacttgatatgcttggccgcattt
ttaatggttctggaaaacctattgataatggtccccctatattgcccgag
gcttatttggatatttctggaagttctatcaacccaagtgagagaaccta
tccagaagagatgattcaaacaggaatatccaccattgatgtcatgaact
cgattgctcgagggcaaaaaattcctcttttctctgctgctggactccct
cataatgaaattgctgctcaaatttgtcgtcaagctggtcttgttaaaag
gttggagcaaagcaagcacgcagcagagggcggtgaagaagacaattttg
caattgtgtttgctgctatgggagtaaacatggaaacggcacaatttttc
aagcgtgacttcgaagaaaatggttcgatggagcgggtcacccttttcct
gaatttggcaaatgaccccactattgagcgtattatcactcctcgaattg
ccctaacaactgctgaatatttggcatatgaatgtgggaagcatgttctt
gtcattctgacagatatgagctcatacgccgatgcacttcgcgaggtctc
cgcagcacgagaagaggtgcctggtaggcgtggttatcctgggtatatgt
atactgatctggccaccatatatgagcgagctggacgtatcgagggaaga
aaggggtcaattacccaaattcctatccttacaatgcctaatgatgatat
cactcatccaactcctgatcttacgggatacattaccgaaggtcagatat
atattgacagacagcttcataatagacagatatacccacccatcaacgtc
ctgccatctctttctcgtctgatgaagagtgctattggtgaaggtatgac
acgccgggatcattcagatgtgtccaatcagctgtatgccaactacgcca
ttgggaaggatgttcaagccatgaaagcagttgtaggagaggaggctctt
tcatccgaggacctgctctatttagaattcctggacaagttcgagaggaa
atttgtagcacaaggagcatatgatactcggaacatttttcagtcacttg
atctggcatggactttgctacgtatattcccccgtgaacttctgcaccgt
attcctgcgaagaccttggatcaattctacagcagagatgccacccattg
atcctttttgttcataaaaaaataattttttcattaagagcagcttgaat
aagagagaaatccaaagttgtactatcattttgctacgctatatagtcaa
atcctatctttcagtctgtatgcacaagttgtaccccacatgtcttgtgc
acctggcagctttgtaatttccatgtagcctcgagtcacaagctagacca
ttttctggttttcatttccctgtattgtgcagcaaaactgaaaagccgtt
taggctacatgcggaagatgttggttat
BLAST
BLAST Search