Query (optional)   in Class  

GrainGenes Sequence Report: L11879

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L11879
Subsequence
L11879_1.cds65292
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC302173
NCBI UniGene
Ta.25138
Data at Gramene
Gramene-Protein P43400
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Metallothionein-like protein'
Keyword
homologue
metallothionein
Species
Triticum aestivum
Cultivar
Warigal
Tissue
aluminum-treated root tip
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum metallothionein-like protein (wali1) mRNA, complete cds.
Remark
DB_xref: taxon:4565
[ Show all 7 ]
EMBL Feature
polyA_site558558Location: 558
feature_gene1558Location: 1..558
5_UTR164Location: <1..64
3_UTR293558Location: 293..558
DNA
atcctcgacaccaaagctcatcttcttctccttgaaatctttttgggttc
atcagatttggaggatgtcttgcaactgtggatccggttgcagctgcggc
tcagactgcaagtgcgggaagatgtaccctgatctgacggagcagggcag
tgccgcggcccaggtcgccgccgtggtcgtcctcggcgtggcgcctgaga
acaaggcggggcagttcgaggtggccgccggccagtccggcgagggctgc
agctgcggcgacaactgcaagtgcaacccctgcaactgttaagctgcatg
cactcgtgtgatggtgtgagagtatacgtgaataacgagcgtccctctga
tctgatggagtcgagcaagggtgcgtgtgcgtgtgcgtgtggtttacttg
ctcgctctccgcctatgctctgcccttggtgtccttgtgtgtatgtgtgt
gcacgtgtccctgtaattgcttcatctatctccactatggatggagtgat
gaatatgtaagaatgaatgatttacctaattaactactcctaaatcgcta
cttcggtt
BLAST
BLAST Search