Query (optional)   in Class  

GrainGenes Sequence Report: L11880

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L11880
Subsequence
L11880_1.cds441087
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC281235
NCBI UniGene
Ta.56212
Data at Gramene
Gramene-Protein Q43662
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Wali2 protein'
Species
Triticum aestivum
Cultivar
Warigal
Tissue
aluminum-treated root tip
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum protein of unknown function (wali2) mRNA, complete cds.
Remark
DB_xref: taxon:4565
[ Show all 7 ]
EMBL Feature
polyA_signal11311136Location: 1131..1136
polyA_site11631163Location: 1163
feature_gene11163Location: 1..1163
5_UTR11163Location: <1..1163
3_UTR10881163Location: 1088..1163
DNA
cttgtgagccgtagcaaattagttcaacaccaaccagctagccatgggta
tgtgttccgacaagaagcgtagcagccctggggttgctctgtggtgtgta
gtcctgggcatagccctgctcgtcgtcgacgcggcgggcagtgaaggtcg
tgcgagagccgggcaattggctgaagagcatggggatgcagcctactgct
ccgccttgtgcaaaggccggtcgcagtcggacttcggaccgtgttacaat
gagtgcttgtacgggagggtgacaggacaagaagaagcaagaggagctgg
tggagttggagggccagctggtctcctggagatgccgacgaaacgcgttg
gacgggaggaagaagagaagacaaagcaaggggacgccaccgtccgtttg
agcgacccagtctggtgctacgacgcttgccgtgaacatccagaattgga
ctacaaccaatgcgtcaatgattgctacgctgagaatatgccggacgccg
catggctggtggcccatggaggaaccggaggagaagaagcaagaggagga
gtggttgatgtcccaatgggggtggtgcagcatgaggctgctgcaggtgc
actgtcacggggcaactgcgatgagtattgccgcaaacactatgatgaag
gctcccccgggtacaggcactgccagtatatgtgcccacgtctgagggtc
cacggggtagcagaaggagaagaagcaagaggaggagctgttgatgggct
gacagtggtggggaaaccccactgcgactggttccgcgactgtagtgtaa
cgccatgcgtctggcgatgtgggaagagggtgcaagaggaggacaatgaa
ggaacaagaacaggagcgctcaatgtcctggcggctgcgcggcatgaggt
tgctgtaggagcatgttcgtcgactgtgtacgtgcaatcatgctatgcct
gttgccaaagggaggttactagagatccggatttcgactggtatgcttgc
attcgcagttgcgacgacaaagatgctatcccaatcaagaaggagcgaga
gaacaagaaggacggcgtagtcccgccggtgaagtagtcgttcgtagtga
gcttatactagcgtgtttcctttccaaacaaataatgtgccgtgcagtga
atccgtcacagtc
BLAST
BLAST Search