Query (optional)   in Class  

GrainGenes Sequence Report: L11881

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L11881
Subsequence
L11881_1.cds55321
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC311860
NCBI UniGene
Ta.56883
Data at Gramene
Gramene-Protein Q43663
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Wali3 protein'
Species
Triticum aestivum
Cultivar
Warigal
Tissue
aluminum-treated root tip
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum protein of unknown function (wali3) mRNA, complete cds.
Remark
DB_xref: taxon:4565
[ Show all 7 ]
EMBL Feature
polyA_signal541546Location: 541..546
polyA_site564564Location: 564
feature_gene1564Location: 1..564
5_UTR154Location: <1..54
3_UTR322564Location: 322..564
DNA
ccacgagcagacgcgggacagtgcagagcttcccagagaagcttaggagc
aacgatgaagagtagcacactcctggtcatcctgatccttcaggccgtcc
tggtcatgggaatcctctcacaggcgaacgccgagttccccaagtgctgc
gacaactgcaggttcttctcgggggccgtggtctgcgatgacgccggccc
caagtgccgggacggctgcgtgaactgccgcgtcgtgcagacgagcccta
agaagacgttccgatgcgccgatgctcgcgccgacgacggcacgccctgc
aagccctgcaagaagcactgatcgcacatgctcaggacataagatgttgg
accgaaaataaaagctcgcatgggttgagcagagcagtggtggctgtacg
tgcccgcggtccacgcccaacaacaattgtagttgtcatcgtcgtcgtta
tgcttttttctctctccagaaaaagctgttgtcattgctccgtgaataaa
cacatacatatgtatcagtgtatgcgtctctgctcaattaaataaaaatc
agtttatttgtgtc
BLAST
BLAST Search