Query (optional)   in Class  

GrainGenes Sequence Report: L11882

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L11882
Subsequence
L11882_1.cds73342
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC333931
NCBI UniGene
Ta.56885
Data at Gramene
Gramene-Protein Q43665
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Wali5 protein'
Species
Triticum aestivum
Cultivar
Warigal
Tissue
aluminum-treated root tip
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum protein of unknown function (wali5) mRNA, complete cds.
Remark
DB_xref: taxon:4565
[ Show all 7 ]
EMBL Feature
polyA_site520520Location: 520
feature_gene1520Location: 1..520
5_UTR172Location: <1..72
3_UTR343520Location: 343..520
DNA
caacacagagcattctaccaccgcaccgcacgagtgaagtgagagctttg
cacgaaaacttcatcagaaaccatgaagggcaccaagctcgcggcgatcc
tgatcctccaggccgtcctggtcatgggactcctctcacacgtgaacgcc
gattttttccccaagtgctgcaacaactgcaggtccttctcgggggtcga
cgtctgcgacgacgcccaccccaagtgtccccagggctgctcggcgtgcc
gcgtggtgtcgacgagccccgaaatgtggcgctgcgcggatatgaaatcc
accgtcgacggcacctgcggtggaccctgcaagaagtactgatcggttca
tgccggcatgatatgttccgcctaaaataaaataaaagctcaggcgagat
gagcagcgtcatcgtgcctatgcgtgtgtgtgtggccaacaatgcttata
ccagtatgtcgtctcttcgtcgctgtgttttctctctcgagaaaaagttg
gtgttgcttgttgttcagct
BLAST
BLAST Search