Query (optional)   in Class  

GrainGenes Sequence Report: L11883

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L11883
Subsequence
L11883_1.cds1389
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC313159
NCBI UniGene
Ta.56884
Data at Gramene
Gramene-Protein Q43664
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Phenylalanine ammonia-lyase'
Keyword
phenylalanine ammonia lyase
Species
Triticum aestivum
Cultivar
Warigal
Tissue
aluminium-treated root tip
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum phenylalanine ammonia-lyase (wali4) mRNA, 3' end, partial cds.
Remark
DB_xref: taxon:4565
[ Show all 6 ]
EMBL Feature
polyA_signal614619Location: 614..619
polyA_site634634Location: 634
feature_gene1634Location: 1..634
3_UTR390634Location: 390..634
DNA
ccctcatgcagaagatgcgtgcagttcttgtggagcacgccttggccaat
ggtgaggccgagcgcgacgtggagacgtcggtgtttgccaagcttgccat
gttcgagcaggagctccgtgcagtgttgccaaatgaggtcgaggccgccc
gcagtgccgtggagaatggcactgcaacacagcaaaaccgtatcgccgat
tgtcggtcgtacccgctctaccggttcgtgcgcaaggagcttggaacaga
gtacttgaccggggagaagacgcggtctcctggcgaagaggtggacaagg
tgttcgttgccatgaaccagggcaagcacatcgacgcgctgctggagtgt
ctcaaggagtggaacggcgagcccctacctatctgttgaacagaggatcc
aggaatggaagagcagttgcttcagatttcagaaggctccagtgattata
ctgttttttcattgtaatttctaaaagttgatgtttgcaacgttcttcca
gagcttccaatgccaaagattgcaattgcatgacttggtagtgttgggta
gccggtagaactttgttgatgtaagttataaaagggtacagtgtgtgata
agtttccatggtaaatatactggttcaagaaagt
BLAST
BLAST Search