Query (optional)   in Class  

GrainGenes Sequence Report: L12707

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L12707
Subsequence
L12707_1.cds172567
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC171533
Data at Gramene
Gramene-Protein P36886
DB Remark
Locus Source: chloroplast Hordeum vulgare subsp. vulgare
Keyword
photosystem I
Species
Hordeum vulgare subsp. vulgare
Cultivar
Svalofs Bonus
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare chloroplast photosystem I PSK-I subunit mRNA, complete cds.
Remark
DB_xref: taxon:112509
Feature: polyA_site: gene = 'Psak'
Feature: source: organelle = 'plastid:chloroplast'; mol_type = 'mRNA'; tissue_lib = 'lambda-ZAP II'
Gene: Psak
Locus Comment: Original source text: Chloroplast Hordeum vulgare (cultivar Svalofs; Bonus) cDNA to mRNA.
EMBL Feature
polyA_site688688Location: 688
feature_gene1688Location: 1..688
DNA
gggtcattgtcctcacagagtgtgcgtggaatgaagccatagttgtgtgg
gtacacaactgaggagtaaagaacacgatcaaccttgataagaccagttg
ctttgtccaactcatacttgactttgctgcctctagcaatcgcagcatcc
acagcgcagaaatccgcagccatggcttcccagctctccgccatgacctc
cgtgccgcagttccacggcctcaggacctactcctcgcccaggtccatgg
cgacgctgccgtccttgaggaggaggaggtcccagggcatccgctgcgac
tacatcggctcctccaccaacctcatcatggtgacgacgacgaccctgat
gctcttcgccgggcggttcgggctggcgccgtcggcgaacaggaaggcga
cggcggggctcaagctggaggcgcgcgagtccgggctgcagacgggcgac
ccggccggtttcacgctcgccgacacgctcgcatgcggcgccgttggcca
catcatgggcgtcggcatcgtgctcggcctcaagaacaccggcgtcctcg
accagatcatcggctagaataacccttccttttccctccatagctgttct
gcatccatcgggcgctccatctagtggatcaactaatgctcccttcgtaa
tttgatcatgtgaatgtatgtgtatgcatctttgtttc
BLAST
BLAST Search