Query (optional)   in Class  

GrainGenes Sequence Report: L13437

[ Printable Version ]  [ Submit comment/correction ]

Sequence
L13437
Subsequence
L13437_1.cds49492
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC294761
NCBI UniGene
Ta.139
Data at Gramene
Gramene-Protein Q06540
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Cold acclimation protein WCS19'
Keyword
cold acclimation protein
Species
Triticum aestivum
Cultivar
Norstar
Tissue
shoot
Developmental Stage
seedling
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum cold acclimation protein WCS19 mRNA, complete cds.
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: On Mar 12, 2002 this sequence version replaced gi:295503.
EMBL Feature
polyA_signal639644Location: 639..644
5_UTR148Location: 1..48
3_UTR493657Location: 493..657
DNA
cacaacctaccctacccacccatccatcagcagtttttctatcgaccaat
ggcttcttcttccgtgctgctcggagcctcggccacggccgcgctcaccg
gcaccccggcaggcaaggcccttccccggccttgcttcctcgccgctcgc
ccgcgcaccgtgagcggtggccgtctctgcctgcagaacgctccaagggc
gactccggcgtacaacgacgctgcggatgccaccgacaaggccatcgacg
gcgtgaagggggtggccgacgagttgaagaagggcgtggcggaggctgcg
gaggccgtctcgggcaacaccgagaaggccgcggaggaagccggcaaggg
cgcgagcgaggtggacgcgaaggccaaggacttcggcgagcaggcgaaga
aggcgacggaggaggcgtgggacggcgccaaggacgccgcacagggcatc
acggacaaagtcgccgccgcggccaaaaaggaagctagctaagctaacac
tacgttgactagtccgatctgtatcgctcaattcattttccattgtaagg
aatgcatatacgtatttcggtacaagagataagatagctgtatttatttt
ctgtgatataggattaccgcactgttaatgtcaaacgcaataaagaaaat
gattttt
BLAST
BLAST Search